Genetics Question of the Day
Test your knowledge with a hand-picked multiple-choice question.
In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)
ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA
Select an answer and click Check.
AI TutorYour personal study buddy
Question of the DayDaily practice to build your skills
FlashcardsStudy and memorize key concepts
AI SolverStep-by-step problem solutions
Learn by ConceptMaster concepts step by step
Practice TestsTest your skills with exam questions
QuizzesTest your knowledge with a quiz
GamesLearn through free games